Nüve Forum

Nüve Forum > kütüphane > Coğrafya ve Tarih > Bölgelere göre tarih > Uzakdoğudan Ortadoğuya İrfan Kültürü

Bölgelere göre tarih hakkinda Uzakdoğudan Ortadoğuya İrfan Kültürü ile ilgili bilgiler


Cevapla

 

LinkBack Seçenekler Stil
  #11  
Alt 12.08.07, 17:32
nuvekolik
Ziyaretçi
 
İletiler: n/a
Standart Cevap: Uzakdoğudan Ortadoğuya İrfan Kültürü










Alıntı ile Cevapla
  #12  
Alt 12.08.07, 17:32
nuvekolik
Ziyaretçi
 
İletiler: n/a
Standart Cevap: Uzakdoğudan Ortadoğuya İrfan Kültürü












Alıntı ile Cevapla
  #13  
Alt 12.08.07, 17:33
nuvekolik
Ziyaretçi
 
İletiler: n/a
Standart Cevap: Uzakdoğudan Ortadoğuya İrfan Kültürü













Alıntı ile Cevapla
  #14  
Alt 12.08.07, 17:34
nuvekolik
Ziyaretçi
 
İletiler: n/a
Standart Cevap: Uzakdoğudan Ortadoğuya İrfan Kültürü

Genlerle İz Sürme

Geçmişe ulaşmanın birinci şartı, bunu yapabilmemizi sağlayacak araçların olmasıdır. Bu araçların ilk başında metinler vardır. Metinlerle ilgili en önemli sorun, yazı öncesi döneme gitmemeleridir. Bu noktada arkeoloji devreye girmiştir ama bu da medeniyetin, yani eşyalı yaşamın ortaya çıktığı dönemden öncesine gitmez. Eşya yoksa arkeoloji de yoktur. Medeniyet öncesi toplulukların arkeolojisi de gayet sınırlıdır. Bir başka araç da genetiktir. Bu da aslında çok fazla bilgi sunmaz. Geçmişteki grupların kültürel içerikleri hakkında bir şey söylemese de, bizi insan gruplarının izledikleri yollar hakkında aydınlatabilmektedir. Genlerle yapılan bu göç çalışmalarının herhalde en önemli katkısı günümüzdeki etnik söylemlerin sorgulanmasını getirmesidir. Bu sayede bugün bulundukları yerlerde yaşayan toplulukların nerelerden geldikleri hakkında çok daha sağlam söylemler üretmek mümkün olabilmektedir.

İlk olarak genler sayesinde iz sürmenin nasıl gerçekleştirildiği konusuna girmek gerekiyor.

Genler üzerinden iz sürmede kuramsal olarak tüm genler kullanılabilir ama soyların izini sürmede önemli olan değişmeyeni bulup çıkartmak olduğundan, bu tür araştırmalarda en çok y-kromozomu ve mitokodriyal DNA***8217;ya başvurulmaktadır. Sadece erkekte bulunan y-kromozomu soyların izini babadan oğla sürmeyi mümkün kılmaktadır. Anneden çocuklarına geçen ama sadece kadınların aktarabildiği mitokondriyal DNA da anneden kıza soy takibine izin vermektedir.

Bu süreci kavrayabilmek için ilk önce haplotip, haplogrup gibi terimlerden ne anlaşılması gerektiğini kavramamız gerekmektedir.

Bilindiği gibi, Y-kromozomu erkekliği harekete geçiren kromozomdur. Bu kromozomun içinde bulunan DNA***8217;nın en büyük özelliği bölünmeye uğramamasıdır. Babadan oğla olduğu gibi aktarılır. Y-kromozomunda bulunan DNA***8217;nın büyük kısmı işlevsizdir, insan bedeninin inşasında bir rolü yoktur. DNA***8217;yı açıp yaydığımızda A G A C G A T C T G T A C C T C T şeklinde giden bir zincir çıkar ortaya. Adenin, guamin, timin gibi bazlara karşılık gelen bu harfler kendilerini belli gruplar şeklinde tekrar eder.


CTGTCTGTCTATCTATCTATCTATCTATCTATCTATCTATCTATCTGCC

Burada TCTA dokuz kez tekrar edilmektedir. Genelde bu tekrarlar hatasız bir şekilde babadan oğla nakledilir. Fakat nadiren de olsa mutasyonlar gerçekleşir ve bu tekrarlar bir sonraki nesle bir fazla veya bir eksik olarak nakledilir. Bu tür birçok tekrar eden parça vardır. Bunlara bakarak bir erkeğin hangi erkeklerle aynı gruptan geldiği tespit edilebilir. Bu parçalara dayanarak yapılan analizler sonucunda çıkan ***8220;kimlik kartına***8221; haplotip deniyor.

Bu mutasyonların son derece nadiren gerçekleşiyor olması, haplotipler bazında bölgesel bir çeşitliliğin ortaya çıkmasına yol açmıştır. Bunlara haplogruplar denir. Bu haplogrupların gerçekleştirdikleri yer değiştirmeler izlenerek insanların nereden nereye gittikleri izlenebilir ve en önemlisi de nereden geldikleri tespit edilebilir. Fakat bundan geçmişteki tüm yer değişikliklerini tespit edebileceğimiz sonucu çıkartılmamalı. Çünkü bazı genetik varyasyonlar (mutasyonlar) zaman içinde kaybolarak bize ulaşmamıştır. Bu da genlerin bile tüm öyküyü veremediklerini göstermektedir.

Yukarıda belirtildiği gibi çok az rastlansa da mutasyonlar vardır. Bu mutasyonların ne tür bir istatistiksel sıklıkla karşımıza çıktıklarını konusunda bir fikir birliğine varılmıştır. Her ne kadar bu hesaplamalarda bir hata payı elbette varsa da, mutasyonların yaklaşık olarak ne zaman gerçekleştikleri tespit edilebilmektedir. Böylece çeşitli grupların ne zaman ortaya çıktıkları saptanabilmektedir. Bu haplogrupların hangi kültürlere karşılık geldiklerini söylemek tabii ki mümkün değildir. Üstelik aynı haplogrubun içinde onlarca farklı kültürel grup var olmuş olabilir. Haplogruplar akrabalık ilişkilerine işaret etmekle beraber, tüm bu akraba bireylerin aynı kültürel gruplar içinde yaşadıklarını getirmemektedir. Ayrıca bu haplogrpların bugünün etnik kimliklerine karşılık geldiklerini de düşünmemeliyiz. Bugünün etnik kimlikleri hâlâ çok yenidir. Mutasyonlar bölgelere göre ayrıldıklarından, bugün var olan grupların nereden geldiklerini anlayabiliyoruz. Aynı haplogrubun içinde birden fazla kültür söz konusu olabilirse de, neticede bu grupların her biri ortak bir kökene gitmektedir. Yani hepsi ortak bir kültürden gelmiştir. Kültürel anlamda bir akrabalık elbette söz konusudur ama diğer yandan bu akrabalığın hangi noktadan sonra artık akrabalık olarak kabul edilemeyeceğini de düşünmemiz gerekmektedir: Beş nesil veya on beş nesil.

Haplogruplar bağlamında bahsettiğimiz bu mutasyonlar doğal ayıklanmaya tabi değildir. Ortaya çıkış nedenleri tamamen rastlantısaldır ve bu yüzden de istatistiksel kurallara dayanan süreçlere tabidirler. Bu da varyasyonların toplum içindeki oranlarının zamanla %100***8217;e ulaşacaklarını veya yok olacaklarını getirir. Yani kuramsal olarak sonunda tek bir varyasyon tüm toplumu kaplayacaktır. Fakat bu süreç çeşitlilik gösteren toplumlarda çok yavaş gelişir. Diğer yandan belli bir büyüklüğe erişmiş bazı haplotipler dışarıdan gelen göçleri içlerinde eritebilirler. On milyonluk bir nüfusa sahip bir yere 100.000 kişilik bir topluluğun göç etmesi oranın genetik çeşitliliğinde büyük bir değişiklik yaratmaz. Ama bunu tam tersi durumlarda, yani çok ufak gruplarda veya çok az çeşitlilik gösteren topluluklarda bu yüzden önemli hatalar ortaya çıkabilir. İstatistiksel olarak bazı varyasyonlar tamamen rastlantısal nedenlerden ötürü büyük oranlara ulaşarak o topluluğun geçmişi hakkında çok yanlış sonuca ulaşılmasını getirebilir. Genetik çalışmalarda bu noktaya dikkat edilmesi gerekmektedir.

Genetik çalışmalar ancak inceledikleri dönemin durumunu sunabilirler. Bugün Türkiye üzerine yapılan genetik çalışmalar ancak bugünkü genetik yapıyı sunar, bundan bin yıl öncesinin yapısını değil. Bundan bin yıl önce Oğuz toplulukları Anadolu***8217;ya geldiğinde var olmuş genetik yapı hakkında bir şey söyleyemeyiz. Bununla beraber, bugün bu topraklarda var olan genetik yapının ne kadarının Orta Asya***8217;dan gelen haplotiplerden oluştuğunu tespit edebiliriz. Burada da belli bir hata payı söz konusudur. Örneğin bu satırların yazarının atalarının Orta Asya***8217;dan geldiğini var sayalım. Bu Orta Asya***8217;dan gelen soyun tespit edilebilmesi için bu ilk atadan bugüne kadar aralıksız bir baba oğul zinciri olması gerekmektedir. Eğer o zincir bir yerlerde kırıldıysa, Orta Asya genleri görülemeyecektir. Bu sorunun olumsuz etkilerini ortadan kaldırmanın iki yolu vardır. Elden geldiğince geniş grupların test edilmesi bir çözümdür. Bu çalışmalardan çıkan sonuçların birikiyor olmaları zaten bu konuda epey geniş veri tabanlarının oluşmasını getirecektir. İkinci yolsa diğer genlerdir. Diğer genler üzerinde çalışmak çok daha zor olmasına rağmen olanaksız değildir. Kız çocuğu annesinden gelen mitokondriyal DNA***8217;yı kendi çocuklarına aktarırken, babasından aldığı diğer genleri de aktarmaktadır ve bu genlerin bir kısmının hangi bölgelerde ortaya çıktıkları bilinmektedir. Bu yüzden Orta Asya bağlantısı ve diğer bağlantılar hiçbir zaman kaybolmayacaktır. Üstelik bu diğer genler doğal ayıklanma sürecine tabi olduklarından, istatistiksel süreçlerden de bağımsızdırlar ama tabi doğal ayıklanmadan ötürü zamanla kaybolabilirler de. Toparlayacak olursak, bir insanda Orta Asya genlerinin tespit edilmesi o insanın kesinlikle Orta Asya bağlantısı olduğunu gösterirken, tespit edilmemesi kesinlikle olmadığını göstermeyebilir. Örneğin bir insanın kökeni otuz beş bin yıl önce Anadolu***8217;da başlamış ve daha sonra bin yıl önce bir Orta Asya kökenli birey bu aileye karışmış olabilir. Bunların tümünün tespit edilebilmesi şu anki gelişmişlik düzeyiyle genetik çalışmaların bile altından kalkamayacakları bir durumdur.

Göç fenomeni tarihsel anlatılarda önemli bir yer teşkil eder. İnsan grupları sürekli yer değiştirmiş ve gittikleri yerlerde farklı gruplarla karışmıştır. Çoğu kez bu yer değiştirmeler yeni gelenlerin eskilerinin yerini aldığı şeklinde anlatılsa da, burada dikkat edilmesi gereken önemli bir mesele vardır: Oranlar. Eğer yeni gelenler çok kalabalık bir yere gelmişlerse, buradaki etkileri ne kadar olacaktır? Genellikle üzerinde durulmayan konu budur. Bu yeni gelenler geldikleri yerdeki dili değiştirebilirler ve bu çoğu kez oradaki halkın tamamen değiştiği şeklinde yorumlanmıştır. Genetik çalışmalar her şeyden önce bunun her zaman doğru olmadığını göstermiştir. Yeni gelenler çoğu kez süratle iktidarı ele geçirdiklerinden kendi dillerini kabul ettirmişlerdir; yoksa eski dili veya dilleri konuşanlar ortadan kalktıklarından değil. Bir diğer nokta da dil değişiminin her zaman bir kültür değişimi olarak algılanmaması gerektiğidir. Dil bir araçtır. Aynı kültür farklı dilleri de kullanabilir ki, bunun en bariz örneği on dokuzuncu yüzyılda Türkçe konuşan ve hatta kendi dillerini tamamen unutmuş Ermeni ve Rum toplulukların Anadolu***8217;da var olmuş olmasıdır. Bu yüzden geçmişte var olmuş bu göçlerin genetik çalışmalar ışığında değerlendirilmesi gerekmektedir. Örneğin on birinci yüzyılda Anadolu***8217;ya gelmiş Oğuz gruplarının etkisini bugünün genetik yapısında baskın genetik unsurlardan biri olarak göremiyorsak, bunun üç açıklaması vardır: (1) Çok az insan gelmiştir (2) Daha sonra farklı göçler olmuştur (3) Anadolu***8217;da yaşayanlarla Orta Asya***8217;da yaşayanlar aynı topluluktan gelmektedir. Üçüncü şıkkın doğru olabilmesi için bu göçten sonra Orta Asya***8217;ya farklı gruplar geldiğini kabul etmemiz gerekmektedir. Çünkü bugünün Anadolu***8217;suyla Orta Asya***8217;sı benzer değildirler; var olan haplogrupların dağılımları farklıdır.

Anadolu***8217;nun bugün sunduğu genetik yapıya baktığımızda karşımıza ilginç bir tablo çıkmaktadır. İncelememizi hem babadan gelen Y-kromozomu hem de anneden gelen mitokondriyal DNA üzerinden yapacağız. Y-kromozomu çalışmalarına baktığımızda çıkan sonuç Cinnioğlu et al***8217;ın[1] çalışmasına göre, Türkiye***8217;de bugün var olan Y kromozomlarında görülen çeşitliliğin 52 farklı haplogrup şeklinde geldiğidir. Bunların arasında başlıca haplogruplar (E3B, G, I, J, L, N, K2 ve R1: %94.1) Avrupa ve komşu Ortadoğu gruplarıyla paylaşılanlardır. Çok daha küçük paylardakilerse Orta Asya (C, Q, O: %3.4), Hindistan (H, R2: %1.5) ve Afrika (A, E3, E3a: %1) gruplarıyla bağlantılı olanlardır. Hem Y-kromozom hem de mitokondriyal DNA üzerinden giden di Benedetto et al***8217;a göreyse, Anadolu genlerinin içindeki Orta Asya katkısı yaklaşık olarak %30 civarındadır. Bu çalışma bu katkının ya bir anda olduğunu ya da her 40 nesilde %1 olacak şekilde gerçekleştiğini ileri sürmektedir. Mergen, Öner ve Öner***8217;in mitokondriyal DNA çalışması 6 ana küme (H, J, T, M, U, W) çıkartmıştır.



Bu sonuçlar üzerine ufak bir tartışma yapacak olursak, bu çalışmanın en yüksek orandaki iki kümesinden biri olan H, aynı zamanda Avrupa***8217;da da en sık rastlanan haplogruptur. En yüksek oranlara batı ve kuzey Avrupa***8217;da ulaşan bu haplogrup, Yakındoğu ve kuzey Afrika***8217;da da yaygındır. Ayrıca kuzey Hindistan ve Yakutlar***8217;ın arasında da tespit edilmiştir. H haplogrubunun kökeninin Yakındoğu olduğu düşünülmektedir. Bu tabloda ikinci büyük küme olan U haplogrubunun yaşı 51000 ile 67000 arasındadır. Ortaya çıktığı yerin Avrupa veya Yakındoğu olduğu düşünülmektedir. Bu çalışmayı özetleyecek olursak Avrupa***8217;ya özgü haplogrupların oranı (H, J, T, W) %43.9***8217;ken Asya***8217;ya özgü M kümesinin oranı %10.6***8217;dır.

Başka bir çalışmada daha farklı bir bakış açısı sunulmaktadır.[2] Bu çalışmada Türk, Gürcü, Oset ve Ermeni grupları karşılaştırılmıştır. Burada Asya kökenli haplogrubun oranının Türkiye için %4.1 olduğu görülmektedir. Diğer yandan Keyser-Tracqui***8217;nin 2000 yıllık bir Hsiung-nu dönemi mezarlığı üzerine yaptığı çalışma buradan çıkan bazı mitokondriyal DNA dizilerinin Anadolu üzerine yapılmış diğer çalışmalarda rastlanmış dizilere benzediğini göstermiştir. Bu çalışmalardan iki sonuç çıkmaktadır: (1) Anadolu ile 2000 yıl öncesi Hsiung-nu dönemine kadar giden bir ilişki kurmak mümkündür. (2) Bu konuyla ilgili çalışmaların verdiği oranlar değişiyor olmasına rağmen, günümüzde Anadolu***8217;da var olan genetik yapının büyük kısmı Orta Asya kökenli değildir.



Bu konuyla ilgili olarak bir de Cavalli-Sforza***8217;nın çalışmasına dayanarak Anadolu***8217;da yaşayan insanlarla bazı topluluklar arasındaki genetik uzaklıklara (veya yakınlıklara) bakalım. Genetik uzaklığı, belli bir karşılaştırma için seçilmiş genlerin iki farklı toplulukta var olan oranları arasındaki uzaklık olarak tanımlayabiliriz.

Burada sunulan tablolar Cavalli-Sforza***8217;nın kitabında sunduğu tablolardan sadece konumuzu ilgilendiren grupların alınmasıyla oluşturulmuştur. İlk tablo 42 topluluktan ibaret bir karşılaştırmadan geliyor.[i] Burada ayrı bir topluluk olarak Türkiye olmamasına rağmen (diğer tablolarda vardır), Yakındoğu olarak adlandırılmış bir kategori bulunmaktadır. Buna ek olarak aynı tabloda Kuzey Türki (Sibirya) ve Moğol-Tunguz kategorileri de vardır. Ayrıca daha farklı karşılaştırmalar için aynı tablodan alınmış Hint, İran, Yunan, İtalyan ve İngiliz kategorileri de aşağıda hazırlanmış çizelgeye eklenmiştir. Böylece şöyle bir çizelge ortaya çıkmıştır:


K.Türki - Moğ.Tun. - Hint - İran - Yunan - İtalyan - İngiliz
Yakındoğu 710 827 229 158 129 208 236

Bu çizelgeyi genetik uzaklıkları küçükten büyüğe doğru tekrar düzenlersek:

Yunan - İran - İtalyan - Hint - İngiliz - K.Türkik - Moğ.Tun.
Yakındoğu 129 158 208 229 236 710 827

Bu çalışmada Kuzey Türki olarak adlandırılmış kategorinin genetik açıdan en iyi bilinen temsilcileri güney Sibirya***8217;da Moğolistan***8217;ın kuzeybatısındaki Tuva, orta Sibirya***8217;nın kuzeyindeki Yakut, günümüzde Ngansanlara yakın yaşayan (Tamir yarımadası) Dolgan ve Moğolistan***8217;ın batısında Rusya ve Çin sınırında yaşayan Altay toplulukları olarak belirtilmiştir. Farklı bir bakış açısı elde etmek için Kuzey Türki topluluklarının en yakın oldukları topluluklarla Moğollara olan uzaklıklarına bakallım[ii].

Norveç Lap - İsveç Lap - ABD Eskimo - Moğ.Tun. - Kuzey Na-Dene
K.Türki 402 533 686 689 1157

Burada Kuzey Na-Dene olarak belirtilmiş grup ABD Eskimolarına komşu bir Amerika grubudur. Bu grup K. Türkilerle Amerika arasındaki ilişkiyi göstermek için dahil edilmiştir. Na-Dene ABD Eskimolarından çok daha eski bir gruptur. Kuzey Türkiler genetik açıdan Laplara daha yakın gözükmektedir.

Bir de Türk (Türkiye) olarak adlandırılmış grubun diğer Türk dili gruplarıyla başka bir tabloda gösterilmiş ilişkisine bakalım. Aşağıdaki çizelgeye Kuzey Çin, Güney Çin, Tibet ve Kore de eklenmiştir.[iii]


-------Doğu Özbek - Altay - Tuva - Yakut - Türkmen - Kuzey Çin - Güney Çin - Tibet - Kore
Türk 167 - 453 - 636 - 735 - 104 - 421 - 1084 - 620 - 794

Yakınlık sırasına göre yeniden düzenlediğimizde:

Türkmen - Doğu Özbek - Kuzey Çin - Altay - Tibet - Tuva - Yakut - Kore - Güney Çin
Türk 104 167 421 453 620 636 735 794 1084

Türkler (çalışmada kastedilen Türkiye Türkleri) Tuva, Altay, Yakut gibi diğer Türk dili konuşan topluluklardan epey uzak gözükmektedir.

Gelelim Batı Asya topluluklarına:[iv]

İran - Kürt - Ermeni - Kuzey Kafkas - Süryani - Bedevi - Dürzi - Irak - Ürdün - Lübnan
Türk 75 114 200 279 99 397 78 112 77 157

Yakınlık sırasına göre yeniden düzenlediğimizde:

İran - Ürdün - Dürzi - Süryani - Irak - Kürt - Lübnan - Ermeni - Kuzey Kafkas - Bedevi
Türk 75 77 78 99 112 114 157 200 279 397

İlk başta bahsedilen dünya tablosuna geri dönüp İran ile Yunanistan arasındaki ilişkiye baktığımızda bu ikisi arasındaki mesafenin 70 olduğunu görüyoruz. Türkiye İran arasındaki genetik mesafeyse 75***8217;tir. Bu hesapların içerdiği hata paylarına bakacak olursak, birincininki 16 ikincininkiyse 4 olarak verilmiştir. Yani bu üç grup birbirine çok yakındır. Yalnız burada Türk olarak adlandırdığımız gruba dikkat etmemiz gerekiyor. Bu grubun içindeki Orta Asya Türk katkısı aslında az. Türk olarak adlandırılan grubu Anadolu topluluklarıyla Orta Asya***8217;dan gelmiş olanların bir karışımı şeklinde düşünmemiz gerekmektedir.




[1] Cinnioğlu et al., Excavating Y-chromosome haplotype strata in Anatolia, 2003.
[2] Tambets et al, The topology of the maternal lineages of the Anatolian and Trans-Caucasus Populations and the peopling of Europe: Some Preliminary Considerations
[i] Cavalli-Sforza, 75.
[ii] age., 228.
[iii] age., 230.
[iv] age., 244.


Gönderen michele timuçin binder @
Alıntı ile Cevapla
  #15  
Alt 12.08.07, 17:36
nuvekolik
Ziyaretçi
 
İletiler: n/a
Standart Cevap: Uzakdoğudan Ortadoğuya İrfan Kültürü

Orhun Yazıtlarını Farklı Bir Şekilde Okumak

Orhun Yazıtları nedir sorusu yöneltildiğinde karşılaşacağımız yanıtlar içeriksel değil, belli bir simgenin verilmesiyle ilgilidir. Bu yanıtların neredeyse hepsinin ortak noktası Orhun Yazıtları***8217;nın kendisini sorgulamamak, bu yazıtlara sadece bir simge olarak yaklaşmaktır. Orhun Yazıtları Türk tarihinin başlangıcıdır, Türklerin tarih sahnesine çıkışıdır; bunu simgeler. Bunu yaparken bir kurgu oluşturulur ve bu kurgu hiçbir şekilde neden Orhun Yazıtları***8217;nın bir başlangıç olarak alınması gerektiğini açıklamaz. Üstelik bir başlangıç olamayacağı yazıtların kendisinden anlaşılır.

Dolayısıyla burada çok farklı bir süreç söz konusudur. Orhun Yazıtları***8217;nın bir başlangıcı veya bu başlangıcın en önemli dönüm noktasını temsil etmesi aslında daha çok Türkiye Cumhuriyeti***8217;nin başlangıcıyla ilişkilidir. Orhun Yazıtları***8217;nı bir başlangıç olarak oluşturan, yeniden üreten ve belli bir şekilde okuyan, bu okumayı hegemonik bir unsura dönüştüren Türkiye Cumhuriyeti ***8220;resmi***8221; tarihçiliği olmuştur.

Bu tek sesli bir okumadır. Sadece devletin sesini duyarız Orhun Yazıtları***8217;nın günümüzdeki hâkim yorumunda. Bu yorumda elbette çeşitli farklı yorumcular, yani tarihçiler ve araştırmacılar yer almıştır ama bunların hiçbiri Orhun Yazıtları***8217;nda farklı seslerin izini takip etmeye veya bu yazıtlardan farklı yorumlar üretmeye çalışmamıştır. Elbette yazıtlarının orijinal sahibinin veya sahiplerinin seslerine sadık kalmak gerekiyor. Neticede bu yazıt belli bir görüşün, belli bir bakış açısının ürünü olduğundan bu bakış açısı elden geldiğince korunmalı. Fakat bu bizi bu bakış açısının niteliğini sorgulamaktan ve farklı öyküleri hissettirip hissettirmediğini sormaktan alıkoymamalı.

Yazının olmadığı, farklı tarihlerin yazılmadığı bir ortamda farklı sesleri bulup çıkarmak dpğası itibarıyla epey zor bir uğraştır. Yine de farklı yazılabilecek bir tarihten bahsedebilir, bu yazıtları farklı şekillerde okuyabiliriz. Neticede biz Köktürk tarihini bu topluluğun yazmış olduğu tarihlerden değil, onlara dışarıdan bakan tarihlerden yola çıkarak oluşturmuşuzdur. Bu yorumlar, Orhun Yazıtları gibi yazıtlar ve diğer medeniyetlerin bu toplulukla ilgili olarak yazdıklarından yola çıkarak belli bir bakış açısı ve belli bir ses yaratmıştır. Bu ses bugünün sesidir. İlk başta bunun ortaya koyulması gereklidir. İkinci olarak da daha farklı seslerin var olabilecekleri gösterilmelidir. Sonuçta tüm bu çalışmalar varsayımsaldır. Çünkü hiç kimse gerçek seslerin öykülerini bilmemektedir ya da bunlar hakkındaki bilgimiz çok kısıtlıdır. Elimizdeki Orhun Yazıtı yorumunun tam olarak Bilge Kağan***8217;ın sesi olmadığını aklımızdan çıkartmamalıyız. Demek ki en azından günümüzde var olan sesler açısından yaklaştığımızda, farklı yorumlar arayışına girebiliriz.

İlk sormamız gereken soru muhtemelen başka seslerin var olup olmadığıdır. Orhun Yazıtları bir tür ***8220;Nutuk***8221;tur. Kül Tigin ve Bilge Kağan***8217;ın öykülerini anlatırlar. Anlatıcılar Bilge Kağan, Kül Tigin***8217;in yeğeni Yolluğ Tigin ve Tenri Kağan***8217;dır. Fakat sadece bir öykü değildir söz konusu olan. Türk halkına neyi yanlış yaptığı, hangi koşullardan geçerek bugüne geldiği, kağanlarının onlar için neler yaptıkları, oysa onların ne kadar vefasız davrandıkları anlatılır bu yazıtlarda. Türk halkı bir parça azarlanır ve zaten bu yazıtlar da herkesin kolaylıkla ulaşabileceği bir yere dikilmiştir ki, böylece yanlış yapan Türkler görüp okusunlar, aynı yanlışa tekrar düşmesinler.

Orhun Yazıtlarını satır satır incelememiz mümkün değil. Onun yerine bazı satırlar üzerinde yoğunlaşarak bunların içinde neler görebileceğimiz üzerinde duracağım. Aşağıdaki satırlar Kül Tigin Yazıtının Güney yüzündendir(G 10, 11). Orijinal şekli dipnottadır.

***8220;Tahta oturup yoksul (ve) fakir halkı hep derleyip topladım: Fakir halkı zengin yaptım, az halkı çok yaptım. Yoksa bu sözümde yalan var mı? (Ey) Türk beyleri (ve) halkı, bunu işitin! Türk (halkı), dirilip (nasıl) devlet sahibi olacağını buraya (taş üzerine) hâkkettim; yanılıp (nasıl) öleceğini de buraya hâkkettim. (Söyleyecek) her ne sözüm var ise ebedi taşa hâkkettim. Ona bakarak (bu sözleri) öğrenin. (Ey) sadık Türk halkı (ve) beyleri, bu devirde (bana) itaat eden beyler, (sizler) mi yanılacaksınız?***8221; [1]

Her ne kadar bu Kül Tigin yazıtıysa da, burada seslenen Bilge Kağan***8217;dır. Bilge Kağan kime seslenmektedir. Orijinal metinde bodun olan sözcüğün halk olarak çevrilmiş olması (Orkun ve Ergin ***8220;millet***8221; olarak çevirmişlerdir) bu dönemde ve yerde var olmuş olabilecek farklılıkları görmemizi daha baştan önlemektedir. Oysa bodun sözcüğü olduğu gibi bırakılabilir veya bugün söylendiği şekliyle, yani boylar olarak yazılabilirdi. Bodun, yani boylar sözcüğü, Bilge Kağan ve çağdaşları tarafından bir insan topluluğu şeklinde algılanmış da olabilir. Fakat bugün kullandığımız halk kavramı bir hiyerarşiyle gelmezken, boylar topluluğunda bir hiyerarşi daha baştan söz konusudur. Yazıtlarda bir sınıf ayırımının söz konusu olduğunu beyler ve boylar sözcüklerinin ayrı ayrı kullanılmalarından anlıyoruz. Halk kavramının günümüzdeki kullanımı bu şekilde değildir. Türk halkı denildiğinde cumhurbaşkanından sokaktaki insana kadar herkes anlaşılır. Bilge Kağan hem beylere hem boylara veya boyların oluşturduğu insan kümesine seslenmektedir ve ayrıca bunların arasında da kendisine sadık kalmış, ona itaat etmiş olanlara seslenmektedir. Demek ki Bilge Kağan***8217;a katılmamış, ona itaat etmemiş olanlar da mevcuttur. Kimdir bunlar? Türük boduna mı aittirler? Yoksa farklı bodunlardan mı bahsediyoruz?

Yazıtlarda her ne kadar hain anlamında bir sözcük yoksa da, düşmanca davrananlardan sık sık bahsedilmektedir. Bu düşmanca davrananlar üzerine seferler düzenleyerek bunların bir düzene sokulmaları gerekmektedir ve hem Bilge Kağan hem de Kül Tigin zamanlarının büyük kısmını bu düşmanca toplulukları yola sokmakla geçirmişlerdir.

***8220;(D 14) Güneyde Çin halkı düşman imiş, kuzeyde Bağımlı Hakan, Dokuz Oğuz halkı düşman imiş, Kırgızlar, Kurikanlar, Otuz Tatarlar, Kıtaylar (ve) Tatabılar hep düşman imiş. Babam hakan bunca***8230;***8230;***8230;.(D 15) kırk yedi kez sefer etmiş, yirmi (kez) savaşmış. Tanrı (öyle) buyurduğu için, devletliyi devletsiz bırakmış, hakanlıyı hakansız bırakmış, düşmanları bağımlı kılmış, dizlilere diz çöktürmüş, başlılara baş eğdirmiş. Babam hakan. öylece devleti (kurup) (D 16) yasaları koyup vefat etmiş.***8221;

Bilge kağanın seslendiği kitle sadece Türkler değildir; Oğuzlara da seslenir.

***8220;(D 22) Onca zengin (ve) onca gelişmiş devletimiz vardı. (Ey) Türk, Oğuz beyleri (ve) halkı işitin! Üstte(ki) gök çökmedikçe, altta(ki) yer (de) delinmedikçe, (ey) Türk halkı, (senin) devletini (ve) yasalarını kim yıkıp bozabilirdi?***8221;

Bu noktada dikkatli olmak gerekiyor. Oğuz olarak adlandırılmış bir topluluğun daha sonra Orta Asya***8217;da var olduğunu ve bunların bir kısmının ilk önce Selçuklu devletini kurduklarını ve daha sonra Anadolu***8217;ya geldiklerini biliyoruz. Aynı Oğuzlardan mı bahsedilmektedir burada? Eğer öyleyse iki farklı topluluğa mı seslenmektedir Bilge Kağan? Diğer yandan buradaki Oğuz sözcüğü farklı bir toplum anlamında kullanılmamış da olabilir. Bu alanın önemli adlarından Golden***8217;a göre, bu bir siyasi terimdir. Bu sözcükle ilgili iki farklı etimolojiye dikkat çeken Golden, Oğuz sözcüğünün bu dönemde bir etnik kimliğe değil, siyasi yapılanmaya işaret eden bir terim olarak düşünülmesi gerektiğini belirtmektedir.[2] Bu bağlamda Oğuz sözcüğü var olan hiyerarşinin belli bir düzeyini temsil eden bir yapılanma, bir kabilesel birlik olarak görülebilir. Üç Oğuz, Altı Oğuz, Sekiz Oğuz, Tokuz Oğuz ve Otuz Oğuz gibi terimlerde bulunan rakamlar bu birliklerin kaç kabileden veya oğuzdan oluştuklarını göstermektedir. Dolayısıyla oğuz terimini içeren sözcüklerle uğraşırken dikkatli olmak gerekmektedir.

Bununla beraber, Oğuz teriminin veya bu ad altındaki kabile birliklerinin Orhun Yazıtları***8217;nda önemli bir yeri vardır. Kül Tigin yazıtlarında Bilge Kağan Doğuz Oğuzların kendi bodunu olduğunu söylemektedir. Fakat yer ile gök arasındaki karışıklık nedeniyle bu oğuzlar onlara düşman olmuştur ve onlarla bir yıl içinde beş kez savaşmak zorunda kalmışlardır. Kimdir bu Oğuzlar? Bilge Kağan onlara da seslenmeye çalışmaktadır ama bunu iki gruba ayrı ayrı seslenerek yapmaktadır. Bundan Oğuzların veya Dokuz Oğuzların Türk olmadıkları sonucunu mu çıkartmamız gerekiyor? Ya da Türk veya Türük sözcüğünü de bir siyasi terim olarak mı almalıyız? Farklı budunlardan bahsedildiği ortadadır. Orhun Yazıtları sürekli budunlardan bahsettiğine göre, etnik kimlikler meselesini nereye oturtmamız gerekmektedir. Budun ile etnik kimlik arasında nasıl bir ilişki vardır. Bunu Orhun Yazıtlarından yola çıkarak anlamak mümkün değildir? O zaman etnik kimlikler konusunda bu derece belirsiz olan bu yazıtları bir etnik grubun, yani günümüzde var olan modern Türk grubunun başlangıç mitine nasıl yerleştirebiliriz? Orhun Yazıtları tamamen siyasi yapılanmalarla ilgili bir mücadelenin öyküsü olarak da alınabilir. Dokuzuncu yüzyıla geldiğimizde daha net bir dünya çıkmaktadır karşımıza. Bu dünyada Oğuzlar olarak adlandırılan bir etnik gruptan bahsetmek mümkün gözükmektedir ama diğer yandan bu etnik grubun ortaya çıkışının aslında dış gözlemcilerin etnik gruplaşmalarla ilgisi olmayan bir dünyayı bu şekilde yansıtmayı seçmiş olmalarıyla bağlantılı olduğu da söylenebilir. Dokuzuncu yüzyıl Oğuzlarının Orhun Yazıtlarıyla ne tür bir ilişkisi olduğunun henüz belirlenmemiş olması da ayrı bir sorundur. Türk dönemine siyasi yapılanmalar dönemi, dokuzuncu yüzyıl Oğuz dönemine de etnik yapılanmalar dönemi olarak mı bakmamız gerekmektedir?

Bilge Kağan***8217;ın düşmanları sadece Oğuzlardan ibaret değildir. Türkçe konuşan topluluklardan kabul edilen başka düşmanlar da vardır: Kırgızlar, Türgişler, Karluklar, Basmıllar, Dokuz Tatarlar. Bunların her biri farklı şekilde tanımlanmaktadır. Örneğin, Basmıllar akraba budundur. Bir ara kervan göndermez olurlar ve üzerlerine sefer düzenlenir. Sonuçları çok sert değildir. Kırgızlarla Karluklara daha sert davranılır. Diğer yandan Tongra boyunu sadece döverler. Bir yerde Dokuz Oğuzların yerini yurdunu bırakıp Çin***8217;e gittiğinden bahsedilir ve burada adı sanı yok olur bu budunun. Bu arada Uygurlar da Türklerin önünden kaçar. Toparlayacak olursak, Orhun Yazıtlarında tek bir grubun öyküsü yoktur. Birçok gruptan bahsedilmektedir ama bunların içinde sadece Türklerin öyküsü olumlu bir şekilde aktarılmıştır. Orhun Yazıtları temelde Bilge Kağan tarafından yazıldıklarından buna şaşırmamak gerekir ama bu yazıtların esasen çok sesli bir dünyaya işaret ettiklerini de unutmamalı. Bilge Kağan ve temsil ettiği siyasal yapıya karşı olanlar vardır ve bunlar, özellikle de Dokuz Oğuzlar, her fırsatta bu yapıya isyan etmişlerdir.

Yazıtlar hemen hemen hiçbir şekilde etnik gruplara işaret etmemektedir. Farklı dil gruplarının varlığı fark edilmektedir ama Türk dili şeklinde sınıflandırabileceğimiz grupların bir etnik birlik içinde hareket ettiklerini söylemek zordur. Budun etnisite anlamında düşünülemez. Bugüne kadar yapılan çalışmalar bu terimin daha çok siyasal bir yapıya işaret ettiğini göstermektedir. Etnisite terimine karşılık gelecek bir yapılanma muhtemelen klanlar düzeyinde aranmalıdır. Üç oğuz, on oğuz, üç tatar gibi terimlerdeki rakamların birbirine karışmaması gereken grupları temsil ettiklerini düşünmemiz gerekmektedir. Rakamların varlığını başka türlü açıklamak mümkün değildir. Muhtemelen bu klanlar veya kabileler arasında ya çatışmalar yoktur, bunlar barış adacıklarıdır, ya da Orhun Yazıtları bu tür alt düzey çatışmalarıyla ilgilenmemektedir. Orhun Yazıtlarında toplumsal örgütlenmeyle ilgili terimler oba, oğuş, uruk, bodun ve il***8217;dir.[3] Bu terimler arasındaki sıra kesin olarak bilinmemekle beraber, bu hiyerarşiyi iç barışın hüküm sürdüğü ve bunun kendiliğinden söz konusu olmadığı düzeyler şeklinde ikiye ayırmak mümkündür. İç barışın zorunlu olduğu örgütlenme düzeyi muhtemelen etnisite kavramına en yakın oluşumları temsil etmektedir. Oba kesinlikle böyle bir gruptur. Buna oğuş da dahil edilebilir. Fakat bodun, il ve hatta ok (tabii Golden***8217;ın tartışmasından yola çıktığımızda oğuz) iç barışın norm olduğu gruplaşmalar değildir. Burada siyasi çatışmaların dünyasındayızdır. Belki de Türk Oğuz çatışmasını budun düzeyinde bir birleşme ve çatışma olarak düşünmemiz gerekmektedir. Orhun Yazıtları bağlamında il çok daha büyük bir siyasi örgütlenmeye karşılık gelmektedir. Burada farklı dil grupları da söz konusudur. Her ne kadar il devlet olarak çevrilmekteyse de, burada bir devlet yapılanmasından bahsedilip bahsedilmeyeceği tartışmaya açıktır ama illerin başında kağanların bulunduğu görülmektedir. Eğer il sözcüğü devletin orijinal anlamına yakın bir şekilde görülürse, yani anlatılmaya çalışılan karizmatik liderliğe dayanan bir iktidar dönemiyse, evet, bir devletten bahsedilebilir. Eğer anlatılmaya çalışılan gelişmiş bürokratik yapılarıyla bir merkezi devletse, devlet kelimesi yanlıştır ve bu terimin bu şekilde kullanılması bu yazıtlardan çok farklı bir yorumun çıkmasına yol açmaktadır.

Orhun Yazıtlarında farklı sesler veya öyküler bulup çıkarma çabası sadece farklı budunlarla sınırlandırılmamalıdır. Bu yazıtlarda dikkat çeken bir başka konu da yoksulluk/zenginlik tartışması ve köleliktir. Çok sık geçen bu konuya değinmemek olamaz. Örneğin ne tür bir zenginlikten bahsetmektedir Bilge Kağan ***8220;halk***8221;ına seslenirken? Bilge kağan***8217;ın anlatımından yola çıkacak olursak, yoksulaşmış Türkleri o zengin kılmıştır ama nasıl yapmıştır bunu veya ne kastetmektedir?

***8220; (KT D 21) O devirde köleler (bile) köleli olmuş idi, cariyeler (bile) kadın hizmetkârlı olmuş idi. (D 22)Onca zengin (ve) onca gelişmiş devletimiz vardı.***8221;

Orijinal metinde ***8220;devlet***8221;in yerinde ***8220;il***8221;, ***8220;zengin***8221;in yerinde ***8220;kazganmış***8221; ve ***8220;gelişmiş***8221;in yerinde ***8220;itmiş***8221; var. ***8220;Kazganmış***8221; bildiğimiz kazanmak sözcüğü; yazıtlardaki kullanım şekli bir şeyler elde etmek anlamında. ***8220;İtmek***8221; sözcüğünü Tekin kendi çalışmasında düzenlemek, tanzim etmek olarak vermiş ama yazıtlarda gelişmiş sözcüğünü kullanmış. Bence düzenlenmiş daha doğru bir seçim olacaktır. Çünkü Orhun budunlarında en önemli meselenin siyasi coğrafyayı düzenlemek olduğu gözüküyor. Zengin olmaya gelince, o köle sahibi olmaktır veya köle sahibi olacak düzeye gelmektir. Öyle bir zenginleşme söz konusudur ki, köleler bile köle sahibi olmuştur. Burada iki şey dikkat çekmektedir. Birincisi bu toplum da kölelik zaten vardır; normaldir. İkinci noktaysa köleliliğin bir dönem epey artmış olduğudur. Demek ki Orhun Yazıtları***8217;nın dünyası sadece budunların ve illerin dünyası değil, aynı zamanda köleliğin dünyasıdır.

Yanlış yapmanın, hatalı davranmanın sonu da köle olmaktır. Kölelikle ilgili olan bu parçayı devam ettirdiğimizde:

***8220;(D 22) (Ey) Türk, Oğuz beyleri (ve) halkı işitin! Üstte(ki) gök çökmedikçe, altta(ki) yer (de) delinmedikçe, (ey) Türk halkı, (senin) devletini (ve) yasalarını kim yıkıp bozabilirdi? (Ey) Türk halkı, (kötü huyundan) vazgeç.***8221;

***8220;(D 23) (ve) nâdim ol! İtaatsizliğin yüzünden, (seni) besleyip doyurmuş olan akıllı hakanın ile bağımsız (ve) müreffeh devletine (karşı) kendin hata ettin (ve) nifak soktun. Silahlı (düşman) nereden gelip (seni) bozguna uğrattı (ve) dağıttı? Mızraklı (düşman) nereden gelip de (seni yerinden yurdundan) sürüp kaçırttı? Kutsal Ötüken dağları halkı, (yerini yurdunu bırakıp) gittin. Doğuya gidenler(iniz)***8221;

***8220;(D 24) gittiniz, batıya gidenler(iniz) gittiniz. Gittiğiniz yerlerde kazancınız şu oldu, hiç şüphesiz: Kanlarını ırmaklar gibi aktı, kemikleriniz dağlar gibi yığıldı; bey olacak erkek evladını köle oldu, hanım olacak kız evladını cariye oldu. Bilgisizliğiniz yüzünden, kötü (davranışlarınız) yüzünden, amcam vefat etti.***8221;

Burada görüldüğü gibi en büyük felaket köle olmaktır. Bilge kağanın köle sahibi olmakla köle olmak arasında gidip gelişi düşündürücüdür. ***8220;Göçebe olup özgürce sürülerini otlatacak, bunların sayılarını arttırarak zengin olacaksın***8221; demiyor. Bunun karşıtı sürülerini kaybedeceksin de değil. Belki köle olmaktan böyle bir sonuç çıkartmamız beklenmektedir ama sürekli kölecilik teriminin kullanılmış olması en azından bu pratiğin epey baskın olduğu bir dünyanın söz konusu olduğunu göstermektedir.

Orhun Yazıtlarında kölelikle ilgili satırlar sadece bu yukarıdakilerden ibaret değildir. Çeşitli örnekler vardır. Orhun Yazıtlarının dışına çıkarak başka kaynaklara baktığımızda gerçekten de bu dünyada köleliğin önemli bir yeri olduğunu görürüz. Örneğin Liu Mau-tsai***8217;den alıntılayan Golden 698***8217;de yer alan bir akında Türklerin 80,000 ile 90,000 arasında Çinli esirle geri döndüklerini belirtmektedir.[4] Türk toplumu pastoral göçebelerden oluştuğu için kölelere neden ihtiyaç duyulduğu sorusunu sorabiliriz. Kliashtornyi köleliğin ev içinde, yurt içinde kullanıldığını ve bu yüzden de asıl hedefin kadınlar ve çocuklar olduğunu belirtmektedir. Diğer yandan tarımla daha fazla uğraşan Yenisey bölgesindeki Kırgızların kölelere daha çok ihtiyacı vardır. Hsiung-nu***8217;ların köle toplumu olarak kabul edilip edilemeyeceği üzerine bir tartışma vardır ve bu konuyla ilgili nispeten yeni bir çalışma 1.5 ile 2 milyon arasındaki Hsiung-nu toplumunda 180,000 ile 190,000 arasında köle bulunduğunu ileri sürmüştür. Orhun Yazıtları döneminde bu bölgede var olmuş bir başka Türk devletinin, Hazar Kağanlığının (650***8211;965) köle ticaretiyle yoğun bir şekilde uğraştığını biliyoruz. Çok daha düşündürücü bir nokta, kölelikle ilgili terminolojide Çin, İran ve Arap dillerinden alınmış sözcüklerin bulunmamasıdır. Diğer yandan imparatorluk unvanlarının, yani ***8220;devlet***8221; terimlerinin büyük kısmının kökeni Türkçe değildir; İran, Tokhar, Hint ve Çin dillerinden alınmış sözcükler çoktur.[5] Buradan çıkacak sonuç kölelik uygulamasının imparatorluk, yani devlet geleneğinden daha yerel olmasıdır. Orhun Yazıtlarının günümüzde var olan ***8220;devletler kuran halk veya millet***8221; söyleminde önemli bir yeri olduğunu dikkate alacak olursak, bu farklılık düşündürücüdür. Çünkü aynı Türk ***8220;devleti***8221; önemli bir köle devleti ve toplumudur, eğer budunların bir toplum oluşturduklarını kabul edecek olursak.


Orhun Yazıtlarında farklı sesleri ve farklı grupları, özellikle de altta kalmış grupları tespit etmemiz mümkündür. Resmi tarihin veya milliyetçi tarihçiliğin türettiği yorum, yazının başında da belirtildiği gibi, kesinlikle eleştirel bir bakış açısı değildir. Burada temel amaç Orhun Yazıtları***8217;nı bir ulusal simgeye dönüştürmektir. İçeriği pek önemli değildir. Oysa içeriğine baktığımızda burada hem Bilge Kağan***8217;ın öyküsünü hem de bu öykünün altında başka öyküleri görebiliriz. En alttaki kölelere sonunda ne olduğunu tespit etmemiz mümkün olmamasına rağmen, Dokuz Oğuzlara ne olduğunu başka yazıtlardan yararlanarak çözebiliriz. Dokuz Oğuz budunu sonunda Türk budunuyla hesaplaşmanın bir yolunu bulmuştur. Bunu bu konuyla ilgili onların bıraktığı bir yazıttan öğreniyoruz. Bu Sine-Usu yazıtıdır ve nedense bu yazıt Orhun Yazıtları kadar popüler değildir. Milliyetçi kanadı temsil eden tarihçilerin büyük kısmı Türklerin Dokuz Oğuzlar tarafından yok edildikleri konusuna girmezler. Daha çok söz konusu olan, Uygurların (yani Dokuz Oğuzlar) iç karışıklıklar sonunda yönetimi ele geçirmesidir. Oysa burada bir Türk-Dokuz Oğuz çatışması görmek, çok daha farklı bir sorunla uğraşılmasını getirecektir. Belki de sorun Türk kağanlığında, onun saldırganlığında veya diğerleriyle uzlaşamamasındaydı. Bu aslında kağanlık olan ama günümüzde devlet olarak adlandırılan yapının sorgulanmasını getirebilir. Diğer yandan, budunlar yerinde sadece millet gören zihniyetin de içinden çıkamayacağı bir durum belirebilir. Neticede Türkleri ortadan kaldıranlar tüm iddialara rağmen Çinliler değil, Dokuz Oğuzlar olmuştur.


Sine-Usu Yazıtı (Kuzey Yüzü) [Orkun, Eski Türk Yazıtları, 165-66]

(***8230;)
(5) Yine düştü, Dokuz Oğuz kavminin hepsini topladım. Babam Kül Bilge Han***8230;
(6) Ordu yürüdü. Kendimi öne binbaşı gönderdi. Keyrede önden (şarktan)***8230;da koyunlu.
(7)İtaata alup yine yürüdüm. Keyre başında Üç Birküde han ordusu ile katıldım. Orada***8230;
(8) Yetiştim. Kara Kum(u) aşmış, Köğürde, Kömür dağında, Yar ırmağında üç tuğlu Türk kavmi***8230;
(9) Tuttum; hatununu orada aldım. Türk kavmi orada bütün (?) yok oldu. Andan sonra tavuk yılında [=745] ***8230;kavm***8230;duyup
(***8230;)

Orijinal Diliyle aynı metin:

(***8230;)
(5) y(a)na [tüşd?]i tok(u)z og(u)z bud(u)n(ı)m(ı)n tirü kobr(a)tı (a)lt(ı)m k(a)n(ı)m kül [b(i)l]ğ[e k(a)g(a)n?]
(6) sü yorıdı öz(ü)m(i)n önre bına b(a)şı ıtı k(e)yr(e)de önd(i)n y(a)nd(a)ç ***8230;da koyl(ı)g tok.
(7) iç(i)ğ(i)r(i)p y(a)na yorıd(ı)m k(e)yre bşında üç birküde kan süsi [b(i)rle?] k(a)t(ı)lt(ı)m (a)nda
(8) irt(i)m k(a)ra kum (a)şm(ı)ş kü(?)ğ(e)rde köm(ü)r t(a)gda y(a)r üg(ü)zde üç tugl(ı)g Türk bud(u)n
(9) ozm(ı)ş tig(i)n k(a)n bolm(ı)ş koy yılka yorıd(ı)m (e)kinti sün(ü)ş [(e)n(i)]ki (a)y (a)lt(ı) y(a)nıka t[okıd(ı)m]
(***8230;)




[1] Tekin, 36,37. ***8220;kagan: olurup yok: çıgan bodunug: kop kubratdım: çıgan: bodunug: bay kıltım: az bodunug: üküş: kıltım: azu bu sabımda: igid bargu: türük: begler: bodun: bunı eşiding: Türük [bodun ti]rip: il tutsıkıngın: bunta: urtum: yangılıp: ölsikingin: yeme: bunta: urtum: neng neng: sabım: erser: benggü: taşka: urtum: Angar körü biling: Türük: matı: bodun: begler: bödke: körügme: beglergü: yangıltaçı siz:***8221;
[2] Golden, The Migrations of the Oğuz
[3] Bastuğ, S. ***8220;Tribe, Confederation and State among Altaic Nomads of the Asian Steppes***8221;, K.A. Ertürk (der.) Rethinking Centarl Asia.
[4] Golden, P. The Terminology of Slavery and Servitude in Medieval Turkic, 30.
[5] Golden, P. Nomads and Sedentary Societies in Medieval Eurasia
Alıntı ile Cevapla
  #16  
Alt 12.08.07, 17:39
nuvekolik
Ziyaretçi
 
İletiler: n/a
Standart Cevap: Uzakdoğudan Ortadoğuya İrfan Kültürü

Merhaba,

İskender***8217;in Uzakdoğu***8217;dan Ortadoğu***8217;ya İrfan ya da Bilgelik Kültürü olarak özetlediği tartışma toplantılarına hoş geldiniz. Üç kişi şeklinde yürüteceğiz bu tartışma dizisini: İskender, Zeynep ve ben. Mayıs ayına kadar sürmesi beklenen bu seminerin ilk birkaç oturumunu daha çok ben üstleneceğim.

Bu ilk oturumlarda konumuz kabaca Orta Asya tarihinin yaklaşık 11. yüzyıla kadarki dönemi süresince bu bölgede var olmuş toplulukların etkileşimleri olacak. Bu etkileşimleri çeşitli konular üzerine düşüncelerimi sunarak aktarmaya çalışacağım. İskender***8217;in deyimiyle bir mutfak çalışması şeklinde geçecek bu tartışmalar dizisi. Yani kendi aramızda zaman zaman yürütmekte olduğumuz tartışmaları daha geniş bir boyutta, sizle birlikte yürüteceğiz. Bu ilk oturumu da kafa karıştırıcı çeşitli ayrıntıları sunmaya çalışacağım bir giriş şeklinde tasarladım.


Çalışma Alanımın zamansal ve uzamsal tanımı

İlk önce bir parça kendi yaklaşımımdan bahsedeyim. Yer olarak üzerinde çalıştığım bölge Yakındoğu, yani Balkanlar***8217;dan Orta Asya***8217;ya uzanan bölge olarak tanımlanabilir. Bu bölgede özellikle yoğunlaştığım alansa Anadolu ve Balkanlar; Orta Asya***8217;yla ilgilenmemse bu bölgedeki çeşitli tarihsel gelişimleri açıklamayla sınırlı kalıyor. Dönem olarak da, Orta Asya***8217;da en fazla on üçüncü yüzyıla kadar, Anadolu ve Balkanlar***8217;daysa yirminci yüzyılın başına kadar uzanıyorum. Zamansal ve uzamsal açılardan baktığımda, çalışma alanımı bu şekilde tanımlayabilirim.

Neyle Uğraşıyorum?

Neyle uğraştığıma gelince, daha çok insan toplulukları, grupları arasındaki etkileşimlerle, bu etkileşimlere bağlı olarak ortaya çıkan kültürel ve medeniyetsel değişimlerle ilgileniyorum. Bu ikisinin içine dinsel, dilsel değişimleri de katabiliriz. Sanırım bu noktada kültür ve medeniyet denen şeyleri nasıl tanımladığımı açıklamam gerekiyor. Her iki kavram da bugüne kadar çeşitli şekillerde tanımlanmış kavramlar. Bu yüzden aslında bu kavramları kullanmamak daha iyi bir tercih olabilir ama ne yazık ki bunların yerini alacak başka kavramlar henüz türetilemedi. Dolayısıyla ben de bunları kullanacağım.

Grup
İnsan topluluk halinde var olan bir hayvan, bir canlı. İnsan bağımsız birey olarak değil, toplumsal birey olarak var olur. Bu tüm hayvanlara özgü bir durumdur. Bazı kedi türlerinde var olma bireysel birey biçimindedir ama bunlar da bile, insanla karşılaştırıldığında çok daha az ve sınırlı düzeyde bir toplumsallık söz konusudur. İnsanın toplumsallığı epey derin ve karmaşıktır. Bizim için grup yaşamı zorunluluk, bireysel yaşamsa çeşitli psikolojik zorlukları da beraberinde getirecek çok az rastlanan bir istisnadır.

İnsan gruplaşmasının bir üst sınırı vardır. Bu, Homo sapiens sapiens türünün biyolojik yapısının dayattığı bir parametredir; kontrolümüz dışında bir parametredir. Bu üst sınır 146***8217;dır. Yani insanların doğal halleriyle oluşturacakları grup büyüklüğünün üst sınırı 150 kişi civarındadır. Bu rakam insan beyninin kabaca diğerleriyle etkileşimleri işlemeden sorumlu neocorteks bölümünün kapasitesiyle bağlantılıdır. Neokorteksin kapasitesi daha büyük grupları kaldırmaz. Eğer bir insanın birkaç yüz kişiyle ilişkisi varsa, bunların hepsiyle yakın ilişkisi yoktur. Bir insan bine yakın başka insanı tanıyabilir ama bu biniyle yakın, kişisel ilişkisi yoktur. Doğal gruptan kastedilen, yakın, kişisel ilişkilerin oluşturduğu gruptur. Bu kişilerin hepsinin aynı grubun üyeleri olması da gerekmemektedir. En azından bu günümüzde artık böyle değildir ama tek bir bireyin yakın grubu bu rakamı geçemez. Bu biyolojik olarak mümkün değildir.

Bu grup üst sınırı, gruplar bu sınırı aşmadığı sürece bir sorun teşkil etmez. Kişilerin teker teker sahip oldukları gruplar, grup 150 kişinin altında olduğu sürece aynı gruba karşılık gelir. Yani herkesi grubu aynıdır. Sorun, daha büyük gruplar ortaya çıktığında belirir. Kalabalıklaşma, doğal gruplarda var olan durumun bozulmasına yol açar. 500 kişilik bir grupta yukarıda bahsettiğimiz türden bir örtüşme gerçekleşmez. Hiçbir bireyin özel grubu tüm grupla örtüşmez. Bu da söz konusun grubun üyeleri açısından bakıldığında farklı bir evreyi başlatır. O ana kadar farklı alt grupların birleştirilmesi, birbiriyle kaynaştırılması gibi bir sorun yoktur; bu noktadan itibaren böyle bir sorun belirmiştir. İki farklı durum belirir. Birincisinden bahsettik. Hiç kimsenin kendi özel grubu bireylerin hepsinin oluşturduğu ana grupla çakışmaz; Ana grubun içinde birden fazla alt grup vardır ve bunların ortak bir çatı altında birleştirilmesi gerekmektedir. İkinci sorunsa bazı bireylerin birbirlerine benzemelerinden ötürü bazı kişilerin özel gruplarının da birbirine benzeyeceği ama diğer yandan bazı kişilerin de bu birbirine benzeyen özel gruplardan oluşan alt grupların sınırlarında kalacağı, melezleşecekleridir. Yani hem tek bir çatı altında toplanacak değerler oluşturma sorunu hem de bir çokkültürlülük sorunu vardır. 500 kişilik bir grup hâlâ çok ufaktır ama karşımıza 100,000 ve hatta bir milyonluk grup çıktığında, her iki sorun da epey karmaşık boyutlara ulaşacaktır.

Kültür
Kültür kavramı bugüne kadar çeşitli şekillerde açıklanmış ve bugün var olan tanımların tamamı da modern çağın ürünüdür. Ben bu tanımlarla ilgilenmiyorum. Bu bahsettiğim grup etkileşimlerinde benim dikkatimi çeken iki mesele var. Bunlardan ilki benzeşme. İnsanlar bir arada yaşadıkları sürece birbirlerine benzerler. Her bireyin kendi tarzı vardır ve bu tarz geldiği grubun özelliklerini temsil eder. Bu tarza, daha doğrusu bu çevremizdekilere benzeme sürecine kültür diyorum. Benzeme sürecine kültürleşme gibi bir terimin daha uygun olacağını düşünenler olabilir ama ben özellikle kültür sözcüğünü seçtim. Genelde kültür sabit ve değişmeyen bir şeyi ima eder ama aslında tam tersi doğrudur. Sürekli değişen bir şeydir ama aynı zamanda da değişmeyen bir şey gibi görünür. Kültürü iki şekilde düşünebiliriz: araçlı ve araçsız. Aracısız versiyonuna doğal, aracılı versiyonuna da yapay diyebiliriz. Aracısız kültür insanın kendisini kullandığı kültürdür. Başkalarıyla kurduğumuz yakın ilişkiler bizi değiştirir, bu etkileşimler sonucu ortaya çıkan bir tarza benzememizi getirir. Herhangi bir araç söz konusu değildir; benzeşme tamamen kişisel yakın etkileşimin sonucudur. Aracılı kültürde başka bir kişiyle veya bir tarzla bir araçla etkileşim söz konusudur. Gelen her neyse önceden paketlenmiştir, etkileşim sırasında tepki de bulunmaz ama etkileşim sonucunda ortaya çıkan yeni paket ilk baştaki paketten farklı olabilir.

Medeniyet
Aracısız kültür neticede insanın kendi öz (biyolojik) kapasitesine bağlıdır. Bu tür etkileşimlerin sonucu ancak ufak kültürel gruplar olabilir. Dolayısıyla büyük kültürel gruplar aracılı kültürler, yani yapay kültürlerdir. Bu alanda her türlü araç kullanılabilir ve bu araçlardan bir tanesi de medeniyet. Medeniyetin bugüne kadar geliştirilmiş en etkili araç olduğu söylenebilir. Aslında medeniyet araçtan ziyade bir teknik, bir yaklaşımdır. Medeniyetin temel özelliği insanın kendi çevresini yaratmasıdır. Burada söz konusu olan doğanın kullanılması veya belli bir şekilde anlamlandırılmasından farklı bir durumdur. Yeni bir çevre yapılır ve bu çevre doğayla insan arasına konur. Burada birincil olan elbette maddi bir dünyanın yaratılmasıdır ama bu beraberinde yeni ve farklı bir manevi dünyayı da getirir. Yapılan bir yer olduğundan, medeniyetin yerle ilişkisi çok farklı bir tutum alabilir. Bulunduğu yeri daha çok sahiplenen zihniyetin ortaya çıkışı neticede eşyalarla, insan yapımı nesnelerle iç içe yaşamaya, toplumsal ilişkilerini aynı insan yapımı nesnelerle kurmaya başlamış insanın bir üst aşamaya geçerek çevreyi de kendisinin yapmasını getirmiştir. Medeniyet eşyaların arka planını oluşturan bir başka eşyadır; bağlamın eşyalaştırılmasıdır. Eşya daha büyük grupların kurulmasını mümkün kılar. Bunu neokorteksin yetersiz yerde devreye girerek sağlar. Bu eşyalar sayesinde ve en önemlisi de bir eşya olarak yeni bir çevrenin yapılması çok sayıdaki doğal grubun aynı çatı altında bir araya gelerek büyük yapay gruplar oluşturmasını sağlar.

Medeniyetlerin Kültürleri
Bu büyük grupların kültürleri biraz önce değindiğimiz araçlı kültür türündendir. Bu büyük gruplarda kültür paketleri söz konusudur. Bu kültür paketlerinin belli merkezlerde yaratılmaları gerekmemekle beraber insanın bu paketlerle girdiği ilişki çok daha farklı bir ilişkidir. Bu toplumlarda yaşayan bireyler bu paketlerin oluşmasında pay sahibi olabilirler ama bu paketlerle ilişkiye girdikleri anda ortaya çıkan etkileşim sırasında paketi değiştirmeleri mümkün değildir. Var olan tek ilişki bu paketin tek yönlü bir şekilde alınmasını getirecek türdendir. Bu paketler paketlerin nasıl kullanılması gerektiğini belirten uygulamalarla da gelir. Medeniyetsel büyük grup kültürlerinin bir zorlama içerdikleri söylenebilir. Aksi takdirde tek çatı yaratacak kültürün doğal etkileşimlerle edinilmesi mümkün değildir. Bu paketin alınmasında da bir diyalogun söz konusu olduğu düşünülebilirse de aslında bir monolog gerçekleşmektedir. Doğal grup kültürüyle bir medeniyet kültürü arasındaki bu fark çok önemlidir. Bu monologsal mesajların çok geniş kitlelere yayılabilmesinin bazı güç merkezlerinin oluşturulmasını gerektiğini de dikkate almamız gerekmektedir.

Farklı İletişim Kaynakları
İnsanlar aralarındaki toplumsal iletişimi gerçekleştirmek için farklı kaynaklara başvururlar. Bunları duygusal, maddi ve simgesel kaynaklar olacak şekilde üç grup halinde düşünebiliriz. Duygusal kaynaklar çok yakın grupların oluşturulmasını sağlarken, maddi ve simgesel kaynaklar sırasıyla daha büyük grupların kurulmasında başvurulan kaynak türleridir. Simgeler milyonları bir çatı altında toplayabilirken, duygusal kaynaklar ancak çok yakın çevremizde kullandığımız jestlerden ibarettir.

Hiyerarşik yapıların ortaya çıkması
Sayı artışı her zaman daha karmaşık yapıların ortaya çıkmasını gerektirir. Yaklaşık beş ile yedi rakamı arasında bir düğüm oluşması gerekmektedir ve bu böylece devam eder. Kalabalık toplumlar her zaman daha karmaşıktır.

Tarih genellikle insanların verdikleri kararların sonucu ortaya çıkan olayların bir araya gelmesi olarak düşünülür ama aslında hem birçok zorunlu, bizden bağımsız parametre söz konusudur hem de rastlantının hiç de azımsanmayacak bir rolü vardır. Bu zorunlu parametrelerden biri biyolojik yapımızdır. Bunun dışına çıkmamız mümkün değildir. Bir diğer zorunlu parametre de rakamların yarattığı koşullardır. Daha kalabalık topluluklar çok daha farklı toplumsal yapılar şeklinde örgütlenecek, toplumsal iletişim çok daha karmaşık bir düzeyde olacaktır.

Tarihsel Yaklaşım

Belirsizlik/Muğlâklık
Tarih genellikle karışık bir şekilde duran verilerin düzenlenmesi şeklinde düşünülür çoğu kez. Oysa burada gerçekleşen bu karışık verilerin belli bir fikir veya yorum doğrultusunda düzenlenmesidir. Bir an için tek bir veri üzerinde yoğunlaştığımızı düşünelim, bu veri tam bir belirsizlik sunar. Ancak başka verilerle bir araya getirildiğinde veya kendi koşulları içinde düşünüldüğünde anlam kazanır. Fakat burada ufak bir hile söz konusudur. Çünkü bağlamın kendisi de fazlasıyla belirsizdir. Elimizdeki veriye anlam kazandırırken diğer verilerin ne anlama geldiğini bildiğimizi var sayarız; oysa aynı sorun bu veriler için de geçerlidir. Elimizdeki verilerden çeşitli anlam grupları oluşturabilir (bir kısmını tamamen dışarıda tutabiliriz) ve bu yüzden de çok sayıda yorum söz konusudur. Nesnel bir bakış açısının sağlanabileceği bir nokta olmadığından, aslında tamamen muğlâk bir alandayızdır. Bu muğlâklığın aşılması ancak gözlemcinin seçim yapmasıyla mümkündür. Bu noktaya tekrar geri döneceğiz.

Benim tarihe bakış açım da bundan farksızdır. Eğer esas olan muğlâklıksa, o zaman yapılması gereken kesin sonuçlar veren öznel anlatılar üretmek değil, aksine bu öznel anlatıları ortadan kaldırarak geçmişi anlamaya çalışmanın belirsizlikle birlikte geldiğini göstermektir. Eğer herhangi bir ***8220;hakikat***8221;ten bahsedilecekse, bahsedilmesi gereken tamamen belirsiz bir durumla karşı karşıya olduğumuzdur. Geçmişi anlamaya çalışmak tamamen diyalogsal bir ilişkiye dayanmaktadır ve bu ilişkinin sonucunda bizi bekleyen hiçbir zaman sabit ve kesin bir bilgi paketi değil, aynı anda hem kesin hem de belirsiz olan bir pakettir. Geçmişe dair ürettiğimiz anlatılar sürekli değişim içindedir veya değişmeye zorlanırlar. Hiçbir şey kesin değildir. Bu belirsizlik içinde geçmişle ilişkiye geçmeye çalışırız. Anlık veya kısa süreli kesinlikle her zaman seçimlerin sonucudur.

Çokkültürcülük
Bu noktada son bir şey daha ekleyerek tarihe yaklaşımımın aynı zamanda çokkültürcü olduğunu da belirtmek istiyorum. Çokkültürcülük denildiğinde farklı şeyler de anlaşılabildiğinden, bu konuyu biraz açmak gerekiyor. Çokkültürcü tarihçilik deyince genelde ilk akla gelen diğer kültürlere yer vermek oluyor. Burada dikkatli olmak gerekiyor. Çünkü çokkültürcü olma adına çok rahat bir şekilde tekkültürcülük sürdürülebilir. Çokkültürcülüğün temelinde farklılıkların kabul eden, onlarla birlikte yaşamanın yollarını geliştiren yaklaşım vardır. Yoksa amaç farklı kültürleri yan yana koyarak hepsini eşit kılmak değildir. Bu reddedilmeye çalışılan özcü bakış açısına geri dönüş anlamına gelir. Bu çokkültürcülük değil, tekkültürcülüğün kültürel veya etnik özler fikridir. Oysa çokkültürcülük de hedef bu özcü bakış açısından ve en önemlisi de her şeyi bir bütün içinde toplama çabasından kurtulmaktır. Onun yerine bütünleri parçalayıp farklılıkları bulup çıkartan bir bakış açısını koymaya çalışır.

Bu tartışmanın başında gruplarla ilgili konuşurken doğal sınırın aşılmasıyla yeni bir evrenin başladığından bahsetmiştim. Eğer gerçekten bazı kültürel özlerden bahsedilecekse, bu daha çok birinci evre için geçerlidir. İkinci evredeki toplumların kültürel özlere karşılık geldiklerinden bahsetmek zordur. Çünkü aynı toplumun içinde haliyle birden fazla kültürel öz var olabilmektedir. Ayrıca melez yapılar da vardır ve en önemlisi de tüm bunlar sürekli değişim içindedir. Değişmez kabul ettiğimiz bir farklılığın içinde bir süre sonra başka farklılıklar belirirken, işe birden bu geçmişlerin günümüzdeki yorumlarının sürekli değiştiğine, sayılarının arttığını dikkate aldığımızda, bu değişimin çok daha fazla olduğunu görürüz.

Burada çokkültürcü yaklaşımın can alıcı noktasına geliyoruz. Farklılıklarla uğraşmak bu farklılıkları taşıyan kişi ve grupların kimliklerini ifade etmelerini sağlamak, anlatılarını hegemonyayı sürdüren anlatı veya anlatılarına yanına eklemek değildir. Amaç hegemonyayı ve arkasındaki gücü sorgulayarak ortadan kaldırmaya çalışarak bu diğer farklılıklara toplumun içinde erişim hakkı vermektir. Çünkü farklı grupların içinde bulunduğu durum yaşamın birçok alanına farklılıklarını koruyarak erişemiyor olmalarıdır. Burada biraz önce bahsettiğim seçim yapma konusuna geliyoruz. Yukarıda değinmiş olduğum muğlâklıktan kurtulmanın yolu seçim yapmaktır ve zaten aslında çok kültürlü olan toplumlarda da asıl sorun budur. Birçok grup bu seçim hakkından yoksun bırakılmaktadır. Diyaloglardan oluşması gereken toplumsal yaşam tek bir monologun hâkim olduğu bir topluma dönüştürülmektedir. Seçim hakkı derken düşünülmesi gereken başka ayrıntılar da vardır. Örneğin, bu seçim hakkının tek bir kültür seçme şeklinde dayatılması da yanlış olabilmektedir. Bazen yapılmak istenen seçim, bu dayatılan seçimin dışına çıkmak şeklinde de olabilmektedir. Bir başka ayrıntı da seçim paketinin değiştirilmesi talebi de olabilir. Çünkü sunulan seçimler hâlâ toplumda var olan hegemonyanın sunduğu bir paket olabilir. Sonuç olarak çokkültürcü yaklaşım hiç de diğer kültürlere söz hakkı tanımak şeklinde gerçekleşmeyebilir. Çünkü söz konusu olan çoğu kez ya melez yapılardır ya da bu farklılıkların da kendi içlerinde çeşitli farklılıklar taşıyor olmalarıdır.

Tabii burada tam bir kargaşanın içine düşülmüş olduğu da düşünülebilir ki, bu bağlamda konuşulması gereken önemli sorunlardan biri de belleğin geçirdiği değişim olmalı.[1] Bütünleri parçalayarak farklılıkları ortaya çıkarma sürecinin belleğin sınırlarını genişletilmesi gibi bir etkisi vardır ki bu da zamanla aşırı uyumu, karar vermenin ve eleştirinin sonunu getirebilir. Farklılıkların tanınması ve onlarla yaşamanın öğrenilmesi, hegemonik olanın da herhangi bir farklılığa indirgenmesi sonunda tarihin yapısını tamamen değiştirebilir, kolektif belleğin yerini bireyselleştirilmiş, parçalanmış bellek alabilir ve tarih otobiyografiye dönüşebilir.

Yoksa gidilen yer tarihin sonu mudur? Sürekli daha büyük toplulukların oluşturulduğu bir ortamda tarihin sonundan bahsetmek hiç de anlamlı gözükmemektedir. Olsa olsa tek bir anlatının hegemonik yapıya bürünmesi, ideolojik nitelendirilecek diğer anlatıların güçlerini tamamen veya büyük ölçüde yitirmelerinden veya marjinalleştirilmelerinden bahsedilebilir ama bunun da uzun vadeli bir sonuç olacağını düşünmek kanımca mümkün değildir. Tarihin yok olması olsa olsa doğal olarak adlandırdığımız gruplara geri dönüldüğünde mümkün olabilir. Bu tür toplulukların elbette geçmişleri vardır ama en azından günümüz ufak topluluklarına baktığımızda bunları tarihsel anlatılar şeklinde yeniden üretmedikleri görülmektedir. Tarihsel anlatıların kesinlikle grupların tek bir çatı altında toplanması süreciye ilgili olduğu görülmektedir. Burada birbirine karşıt çalışan iki süreç söz konusudur. Bunlardan biri tüm alt grupları bir çatı altında toplamaya çalışan süreçtir. Diğeriyse bu alt grupların bu süreç sırasında kaybolmamak için verdikleri mücadeleyle ilgilidir. Bir yandan ayrıntıları ve farklılıkları sürekli genelleştiren, basitleştiren bir süreç söz konusuyken, diğer yandan da aynı ayrıntıları ve farklılıkları öne çıkararak var olan hegemonik toplumsal bellekleri sürekli parçalayan bir süreç söz konusudur. Böylece en başta bahsettiğimiz geçmişin belirsizliği, muğlâklığı bir kez daha tam anlamıyla karşımıza çıkar.

Asya***8217;ya sıçrayış

Tam bu noktada Asya***8217;ya sıçrayabiliriz. Bu ilişkiyle uğraşmanın şu anda var olan en iki farklı yöntemi vardır. Bunları kabacı Batı ve Doğu yöntemleri diye ikiye ayırabiliriz. Batı ve Doğu medeniyetlerinin farklı düşünme şekilleri geliştirdikleri konusuna daha önceki bir seminerde değinmiştik. Şu anda bu konuya girmeyeceğim. Sadece burada şekillendirdiğim bu ilişkinin çözümü konusunda Doğu düşüncesinin kanımca çok daha etkili bir yöntem sunduğuna değinmekle yetineceğim.

Sanırım bu tartışma dizisinin Doğu hakkında olmasının ilk nedeni böyle bir farklılığın olması. Bu farklılığı mutlak sınırlar içinde düşünmemiz gerekmiyor. Batılıların hepsi Batı yöntemiyle ve Doğuluların hepsi de Doğu yöntemiyle düşünüyor diye bir iddia da bulunmamız gerekmiyor. Batı***8217;da Doğulu yöntemiyle düşünenler olduğu gibi, Doğu***8217;da da Batı yöntemiyle düşünenler bulunmaktadır. Bu arada elbette melez yapılar da vardır.

Böyle bir ayrımdan bahsetmek bizi haliyle Doğu***8217;yu Batı***8217;dan ayıran çizginin nerede olduğu sorusuna getiriyor ki bu önem vermemiz gereken bir ayrıntı. Türkiye Doğu***8217;da mı, yoksa Batı***8217;da mı? Bu soruya siyasi açıdan yaklaştığımızda Türkiye***8217;nin Doğu***8217;nun bir parçası olduğu düşünülecektir ama hangi Doğu? Doğu dediğimiz şey aslında epey büyük. Bir an için coğrafi sınırları unutup Batı***8217;nın ötekisi olarak Doğu üzerinde yoğunlaştığımızda, bu Doğu kurgusunun aslında epey geniş bir alanı ve muazzam bir çeşitliliği kapsadığını görürüz.

Doğu***8217;yu Asya olarak da düşünebiliriz, her ne kadar kanımca Asya Doğu***8217;nun bir parçasıdır. Büyük bir parçasıdır ama yine de parçasıdır, kendisi değil. Çünkü Orta Doğu denen bir şey vardır. Doğu***8217;yla ilgili kategorilerin neredeyse hepsi Batı medeniyetinin ürünüdür. Ortadoğu***8217;yla Yakındoğu aynı şeyler değildir. Yakındoğu Uzakdoğu***8217;nun karşıtı gibi gözükmektedir. Peki, bu Yakındoğu denen şey nereden başlamaktadır? On dokuzuncu yüzyılda Yakındoğu Osmanlı dünyasıydı. Osmanlı küçüldükçe, Yakındoğu da küçüldü diyebiliriz; en azından batı yönünden. Yakındoğu***8217;yla karşılaştırınca Ortadoğu daha yeni bir terim. Bugünkü kullanımı açısından bakarsak (Türkiye***8217;de bu bölgeye dahil edilmektedir), garip bir durum ortaya çıkmaktadır. Doğu***8217;nun ortası ve uzağı vardır ama yakını kalmamıştır. Fakat konumuza dönecek olursak, Yakındoğu teriminin on dokuzuncu yüzyılda Osmanlı topraklarını ifade ettiğini dikkate aldığımızda Asya***8217;nın Doğu***8217;nun bir kısmını temsil ettiğini görüyoruz. Doğu***8217;nun diğer parçası da Balkanlar olmuştur ki bunun hâlâ geçerli olduğu bile söylenebilir.

Asya terimine gelince, özünde bir Batı teriminden bahsediyoruz. Asya dillerinde buna karşılık gelen bir terim yoktur ama Arap dünyasında ve Hintlilerin arasında bu terime yakın ***8220;Hint Denizi***8221;, ***8220;Çin Denizi***8221; gibi terimler olmuştur.[2] Bugün Asya olarak adlandırdığımız bölgede çok daha farklı coğrafyalar olmuştur. Bunları kaba bir şekilde Çin***8217;i merkez alanlar ve Hindistan***8217;ı merkez alanlar şeklinde sınıflandırabiliriz. Elbette bunların dışında kalan halklar da kendi coğrafyalarını oluşturmuştur. Neticede burada görmemiz gereken şey, Asya***8217;nın Batı coğrafyasına ait bir terim olduğu ve dünyanın diğer bölgelerinde sonradan benimsendiğidir. Üstelik bu Asya yaklaşımı hiçbir zaman düzgün, sorunsuz bir gelişim de göstermemiştir. İlk başta yaygın olan terim daha çok Hint***8217;tir ve bu terim bir süre hem Avrupa***8217;nın doğusunda hem de batısında var olmuştur. On beşinci yüzyılda İspanyollarla Portekizlilerin dünyayı ikiye bölmelerine dayanan bu Hint yaklaşımı hem Hıristiyan hem de Müslüman olmayanların yaşadıkları bölgeleri kapsamıştır.[3] Yani bir diğerleri kategorisidir; nereye ait olduğu bilinmeyenlerin konulduğu bir kategori.

Bu arada kıtalardan ne kastedildiği de apayrı bir konudur. Bir yanda bir Avrupa kıtası vardır ki bazı araştırmacılar buna karşıdırlar. Avrasya terimi yerine Afrasya teriminin daha yerinde olduğunu düşünmektedirler. Bu araştırmacılara göre Avrupa zaten Asya***8217;ya ait bir yarımadadır. Yoksa Batı Asya Avrupa mıdır? Avrupa kıtasını tamamen dünya dediğimiz gezegende kıtaların evrimi açısından inceleyecek olursak, aslında farklı bir kıtanın en az bu açıdan var olduğunu söyleyebiliriz. Çarpışmanın izleri hâlâ gözükmektedir. Eğer kıtadan anlaşılması gereken farklı yerküre parçalarıysa, evet, Avrupa***8217;nın farklı bir jeolojik geçmişi vardır diyebiliriz. Fakat kıtalar bu şekilde oluşturulmamıştır. Çok daha öznel kriterler söz konusu olmuştur ki, jeolojik bir yaklaşımı da savunmak da sonuçta nesnel bir kriterin söz konusu olduğunu göstermez. Avrupa türdeş Avrupa halklarının oluşturduğu bir kültürel birliğe işaret eder. Bu düşüncenin ortaçağda ortaya çıktığını söyleyebiliriz. Konuya bu açıdan yaklaştığımızda herhalde Hindistan da bir kıtadır ki, Avrupa***8217;dan çok daha kalabalık bir dünya söz konusudur ve jeolojik tarihi açısından bakıldığında hiç de farklı bir çizgi izlememiştir. Aslında tartışmayı sadece jeolojik geçmişle sınırlayacak olursak, Avrupa***8217;yla Asya***8217;nın birleşik oldukları başka bir dönem daha vardır. Bu açıdan baktığımızda Avrupa aslında Asya***8217;nın ondan daha önce kopmuş parçasıdır. Hindistan çok daha farklı bir çizgiden gelmektedir. Afrasya terimi daha anlamlıdır. Aslında jeoloji yararsızdır. Çünkü kıtaların oluşumu daha farklı dinamiklere bağlı olmuştur ve bu dinamikler arasında ortaçağ Avrupa***8217;sının başta olduğu söylenebilir. Asya medeniyet anlatılarındaysa, biraz yukarıda değinildiği gibi, başı Hindistan ve Çin çekmiş ve modern çağda bu gruba Japonya***8217;da katılmıştır.

Toparlayacak olursak, modern çağa geldiğimizde artık bir Asya kıtası vardır ama bu kıta o kadar büyük bir çeşitliliğe sahiptir ki, karşımızda Avrupa kıtasından çok farklı bir oluşum vardır. Asya kıtasının kesinlikle farklı kıtalara veya alt kıtalara bölünmesi gerekmektedir. Örneğin, Hindistan***8217;ın farklı bir yerde olduğunu düşünebiliriz ama tarihsel ilişkiler açısından baktığımızda, en azından Budizm***8217;in yarattığı türdeşliği göz önüne aldığımızda bir Çin - Hindistan - Güneydoğu Asya (HindiÇin) - Japonya ve Moğolistan***8217;ın oluşturduğu nispeten türdeş bir yeden bahsedebiliriz. Türkiye ve Ortadoğu kesinlikle bunun dışındadır. Belki Orta Asya bir ara bölgeyi temsil etmektedir ama İran***8217;dan itibaren kesinlikle farklı bir dünyaya adım atarız. Burada İran***8217;la Hindistan***8217;ı birleştirmek elbette mümkündür. Üstelik Hint Okyanusu***8217;nun temsil ettiği bir dünya kurgulamaya kalkıştığımızda karşımıza daha farklı bir oluşum da çıkabilir. Diğer yandan Asya***8217;nın kuzeyine kaçan bir bölgede Pasifik***8217;ten Hazar Denizi ve Batı Sibirya***8217;ya doğru başka bir bölgede düşünebiliriz. Aslında burada dikkate almamız gereken en önemli nokta, Asya olarak adlandırdığımız bölgedeki türdeşleşmelerin henüz Avrupa***8217;daki kadar kesin çizgilerle belirmediğidir. Avrupalılık özellikle üzerinde çalışılmış bir kültürel birliği temsil ederken buna benzer bir durum Asya çapında söz konusu değildir.

Bu tartışmayı burada noktalayıp Türkiye açısından bakıldığında çok daha önemli olan bir noktaya değinmek istiyorum. Yukarıda bahsettiğim tarihsel coğrafi anlatılarla Türkiye***8217;de var olan tarihsel coğrafi anlatılar arasında çok önemli bir fark vardır. Şu ana kadar bahsetmiş olduğum tüm anlatılarda (Avrupa, Çin veya Hindistan) dünyanın merkezi her zaman bu medeniyetlerin bulunduğu yerlerdir. Örneğin Çin***8217;de bir Orta Krallık kavramı vardır. Bu açıdan bakıldığında tüm bu medeniyetsel oluşumlar bir uyum içindedirler. Bir tek Türkiye***8217;nin durumunda gariplik vardır. Orta Asya ve Türkiye farklı yerlerdedir. Türkiye***8217;nin yarattığı anlatı aslında bir diaspora anlatısıdır. Türkiye hem anavatandır hem de değildir. Söz konusu olan kendisini daha baştan bir diaspora medeniyeti olmaya mahkum etmiş bir oluşumdur. Bu noktada Orta Asya kavramına giriyoruz.

Orta Asya nerededir? Türkiye***8217;nin Orta Asya***8217;sıyla bu konuyla ilgilenen araştırmacılar Orta Asya***8217;sı farklı yerlerdedir. Türkiye***8217;nin Orta Asya***8217;sı Orhun Yazıtları***8217;nın bulunduğu Moğolistan***8217;dır. Oysa burası araştırmacılara göre İç Asya***8217;dır. Orta Asya bir zamanlar çeşitli İran dilleri konuşan toplulukların yurdu olan Aral gölü çevresindeki coğrafi bölgedir. Aslında Anadolu***8217;da bugün yaşayan insanların bir kısmının kökenleri açısından bakıldığından asıl başlangıç noktası da bu bölgedir. Diğer yandan kökenleri daha geriye götürmek isteyen, daha özsel bir kültüre ulaşmaya çalışan anlatılar açısından bakıldığında, aranılan merkez, başlangıç noktası İç Asya***8217;dır. Tabii bir de bu iki bölgeyi birbirinden ayıran ilginç bir yer olarak Altay dağları vardır.

İç Asya tek merkez değildir. Çünkü Türkiye***8217;de iki tane merkez anlatısı vardır. Biri İç Asya, yani Orta Asya köken mitidir. Diğeriyse tüm medeniyetlerin beşiği miti şeklinde sunulan Anadolu anlatısıdır. Coğrafi açıdan bu ikisi arasında bulunan Orta Asya ise aslında bir köken anlatısı olarak mevcut değildir; daha çok bir yadımcı aktördür. Kaynakça

Chaudhuri, K.N. 2000. Asia Before Europe, Economy and Civilisation of the Indian Ocean from the Rise of Islam to 1750, Reprint, New York: Cambridge.
Levi, G. 2002. ***8220;The Distant Past: On the Political Use of History***8221;, J. Revel ve G. Levi (der.) Political Uses of the Past, The Recent Mediterranean Experience Londra: Frank Cass.
Mitani, H. 2006. ***8220;The Concept of Asia: From Geography to Ideology***8221;, New Perspectives on Turkey, No. 35, Güz 2006, Special Issue on Comparative Turkish and Japanese Modernities, İstanbul:
Homer.Scotese, C.R. Paleomap Project, http://www.scotese.com/earth.htm[1] Levi, 66.
[2] Chaudhuri, 22.
[3] Mitani, 25.



Gönderen michele timuçin binder @
Alıntı ile Cevapla
Cevapla

Tags
kültürü, ortadoğuya, uzakdoğudan, ırfan

Seçenekler
Stil

Yetkileriniz
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is Açık
[IMG] Kodları Açık
HTML-KodlarıKapalı
Trackbacks are Açık
Pingbacks are Açık
Refbacks are Açık



Bütün zaman ayarları WEZ +2 olarak düzenlenmiştir. Şu anki saat: 03:06 .